medigraphic.com
SPANISH

Revista del Instituto Nacional de Enfermedades Respiratorias

A partir del año 2010, la Revista Oficial del INER cambió a NCT (Neumología y Cirugía de Tórax)

Ver actualización

  • Contents
  • View Archive
  • Information
    • General Information        
    • Directory
  • Publish
    • Instructions for authors        
  • medigraphic.com
    • Home
    • Journals index            
    • Register / Login
  • Mi perfil

2001, Number 1

<< Back Next >>

Rev Inst Nal Enf Resp Mex 2001; 14 (1)

Diagnosis of tuberculosis by detection of Mycobacterium tuberculosis with a non-commercial polymerase chain reaction.

Laniado-Laborín R, Enríquez-Rosales ML, Licea NAF
Full text How to cite this article

Language: Spanish
References: 13
Page: 22-25
PDF size: 154.97 Kb.


Key words:

Tuberculosis, diagnosis, polymerase chain reaction, PCR.

ABSTRACT

Objective: To evaluate the efficacy of a non-commercial direct amplification test based on the polymerase chain reaction to identify Mycobacterium tuberculosis in patients with presumptive diagnosis of pulmonary tuberculosis and smear-positive sputum. Material and methods: Sputum and pleural fluid samples were analysed with the direct amplification technique, using the sequences 5’CAGCCCGCTGGAGTCCCGCGGA3’ and 5’GCGCGTTCACCATGGACACCG3’ as primers and a Lowenstein-Jensen culture as gold standard. Results: Seventy-nine consecutive patients and a total of 212 specimens were analysed. Using the gold standard, PCR sensitivity in sputum samples was 97% and positive predictive value, 57%. PCR was positive in 54 (98.18%) of the 55 specimens with positive septum microscopy. Conclusions: Sensitivity and positive predictive value of the non-commercial primers used to identify Mycobacterium tuberculosis in smear-positive sputum are comparable to reported clinical studies. Its clinical application will allow rapid identification of Mycobacterium tuberculosis infected patients, discerning them from patients infected with non-tuberculous mycobacteria.


REFERENCES

  1. Heifets L. Dilemmas and realities of rapid diagnostic tests for tuberculosis (editorial). Chest 2000; 118: 4-5.

  2. American Thoracic Society. Diagnosis and treatment of disease caused by non tuberculous micobacteria. Am Rev Respir Dis 1990; 142: 94.

  3. American Thoracic Society. Diagnostic standards and classification of tuberculosis. Am J Respir Crit Care Med 2000; 161: 1376-1395.

  4. Peter CR, Schultz E, Moser K, Cox M, Freeman R, Ramírez-Zetina M, et al. Drug-Resistant pulmonary tuberculosis in the Baja California-San Diego County border population. West J Med 1998; 169: 208-213.

  5. Moran-Moguel MC, Hernandez DA, Peña-Montes de Oca PM, Gallegos-Arreola MP, Flores-Martínez SE, Montoya-Fuentes H, et al. Detection of Mycobacterium tuberculosis by polymerase chain reaction in a selected population in north-western Mexico. Rev Panam Salud Pública 2000; 7: 389-393.

  6. Parra CA, Londoño LP, Del Portillo P, Patarroyo ME. Isolation, characterisation and molecular cloning of a specific Mycobacterium tuberculosis antigen gene: Identification of a species-specific sequence. Infect Immunity 1991; 59: 3411-3417.

  7. Del Portillo P, Murillo LA, Patarroyo ME. Amplification of a species-specific DNA fragment of Mycobacterium tuberculosis and its possible use in diagnosis. J Clin Microbiol 1991: 29: 2163-2168.

  8. Balandrano-Campos S, Anzaldo-Flores G, Peña-Flores GP, Betancourt-Morillo X. Manual de procedimientos de laboratorio INDRE/SAGAR: Tuberculosis. Secretaría de Salud, Secretaría de Agricultura, Ganadería y Desarrollo Rural. Organización Panamericana de la Salud. 1996.

  9. American Thoracic Society. Rapid diagnostic tests for tuberculosis. What is the appropriate use? Am J Respir Crit Care Med 1997; 155: 1804-1814.

  10. Gallina M, Troupioti P, Rocco G, Sensalari G, Libanori E. Predicting culture results for Mycobacterium tuberculosis complex. Amplified Mycobacterium tuberculosis direct test. Chest 2000; 116: 28-32.

  11. Lebrún L, Mathieu D, Saulnier C, Nordmann P. Limits of commercial molecular tests for diagnosis of pulmonary tuberculosis. Eur Respir J 1997; 10: 1874-1876.

  12. Barnes PF. Rapid diagnostic tests for tuberculosis. Progress, but not gold standard. Am J Respir Crit Care Med 1997; 155: 1497-1498.

  13. Gladwin MT, Plorde JJ, Martin TR. Clinical application of the Mycobacterium tuberculosis direct test. Chest 1998; 114: 317-323.




CC BY-NC-ND

2020     |     www.medigraphic.com

Mi perfil

C?MO CITAR (Vancouver)

Rev Inst Nal Enf Resp Mex. 2001;14